Journal:

Article Title: Helicobacter pylori rocF Is Required for Arginase Activity and Acid Protection In Vitro but Is Not Essential for Colonization of Mice or for Urease Activity

doi:

Figure Lengend Snippet: Oligonucleotide primers, plasmids, and bacterial strains used in this study

Article Snippet: The oligonucleotide primers, plasmids, and bacterial strains are listed in Table . table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Oligonucleotide primer, plasmid, or strain Coordinates in rocF a Relevant genotype or description DNA sequence (5′ to 3′) Source or reference Primers b RocF-F3 (for) −149–−130 GC CTGCAG TATTGGGGTGTTTTTCTATC ( Pst I site underlined) RocF-R13 (for) 18–37 AA CTGCAG AAGCAGAGTTAGGAGCG ( Pst I site underlined) RocF-F4 (for) 204–223 AAATCTGATCCCTTGCATGA RocF-R14 (rev) 339–360 CG GGATCC GCATGCGCGTCTAAATAC ( Bam HI site underlined) RocF-R6 (rev) 554–573 TTCGCTCTGTTCGGTGCTTC RocF-R15 (for) 562–580 CG GGATCC GAACAGAGCGAAAGAGATG ( Bam HI site underlined) RocF-R17 (rev) 691–708 GTCCAAATCCAAACTGAG RocF-R16 (rev) 898–915 CG GAATTC GATGAGATCTAAGATCTC ( Eco RI site underlined) RocF-R5 (rev) 987–1006 GG ATCGAT CTTTTTCAACCTTTTATCGT ( Cla I site underlined) Kan-H16 (rev) NA CGGTATAATCTTACCTATCACCTCA Kan-K4 (rev) NA TCCAATTCACTGTTCCTT Kan-K5 (for) NA TATATTTAAAAATGACGG Kan-K8 (for) NA TTTGACTTACTGGGGATCAAGCCTG Plasmids (parent) pBluescript II SK (−) Ap r , cloning vector Stratagene pBS- rocF (pBluescript II SK) Ap r , 1,154-bp rocF PCR product (nucleotides −149 to 1006) cloned into the Pst I and Cla I sites This study pBS- rocF::aphA3 (pBluescript II SK) Ap r Kn r , 1.2-kb Eco RI aphA3 cassette from pHP1 ligated to the Eco RI site of rocF in pBS- rocF This study pHP1 (pUC19) Ap r Kn r , source of aphA3 cassette H. Kleanthous pILL570 Sp r , cloning vector 11 pILL570 Not (pILL570) Sp r , Not I and Eco RI sites have been introduced between the Cla I and Hin dIII sites in the pILL570 polylinker This study pILL600 Kn r , source of aphA3 cassette 12 pILL235 (pILL570 Not) Sp r , 676-bp rocF spliced PCR products (nucleotides 18 to 339 and 562 to 915) This study pILL236-2 (pILL570) Sp r Kn r , aphA3 cassette from pILL600 ligated to the Bam HI site in rocF in pILL235 This study Strains E. coli DH5α F − supE44 ΔlacU169 (φ80 lacZ ΔM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1 Bethesda Research Laboratories H. pylori 26695 WT, genome sequenced 4 , 34 26695 rocF::aphA3 26695 allelic exchange arginase ( rocF ) mutant by using pBS- rocF::aphA3 This study N6 WT, naturally transformable laboratory strain 6 N6 236-2 N6 allelic exchange arginase ( rocF ) mutant by using pILL236-2 This study N6 rocF::aphA3 N6 allelic exchange arginase ( rocF ) mutant by using pBS- rocF::aphA3 This study SS1 WT (mouse-adapted) 13 SS1 236-2 SS1 allelic exchange arginase ( rocF ) mutant by using pILL236-2 This study SS1 rocF::aphA3 SS1 allelic exchange arginase ( rocF ) mutant by using pBS- rocF::aphA3 This study Open in a separate window a +1 refers to the A residue in the start codon of rocF .

Techniques: Plasmid Preparation, Sequencing, Clone Assay, Mutagenesis

Journal:

Article Title: Helicobacter pylori rocF Is Required for Arginase Activity and Acid Protection In Vitro but Is Not Essential for Colonization of Mice or for Urease Activity

doi:

Figure Lengend Snippet: Schematic diagrams of rocF constructs used in this study. pBS-rocF::aphA3 and pILL236-2 contain the aphA3 kanamycin-resistant cassette. Thick arrows denote the direction of transcription. Restriction enzyme abbreviations: B, BamHI; C, ClaI; E, EcoRI; H, HindIII; P, PstI. Thick lines refer to vector sequences. The symbols ‘ and ’ refer to truncations at the 5′ or 3′ end, respectively. +1 refers to the first nucleotide in the coding region of rocF. Thin arrows denote primers used for PCR confirmation and sequencing of rocF mutants. See Table ​Table11 for primer sequences, Table ​Table22 for the PCR strategy, and Fig. ​Fig.2B2B for the results.

Article Snippet: The oligonucleotide primers, plasmids, and bacterial strains are listed in Table . table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Oligonucleotide primer, plasmid, or strain Coordinates in rocF a Relevant genotype or description DNA sequence (5′ to 3′) Source or reference Primers b RocF-F3 (for) −149–−130 GC CTGCAG TATTGGGGTGTTTTTCTATC ( Pst I site underlined) RocF-R13 (for) 18–37 AA CTGCAG AAGCAGAGTTAGGAGCG ( Pst I site underlined) RocF-F4 (for) 204–223 AAATCTGATCCCTTGCATGA RocF-R14 (rev) 339–360 CG GGATCC GCATGCGCGTCTAAATAC ( Bam HI site underlined) RocF-R6 (rev) 554–573 TTCGCTCTGTTCGGTGCTTC RocF-R15 (for) 562–580 CG GGATCC GAACAGAGCGAAAGAGATG ( Bam HI site underlined) RocF-R17 (rev) 691–708 GTCCAAATCCAAACTGAG RocF-R16 (rev) 898–915 CG GAATTC GATGAGATCTAAGATCTC ( Eco RI site underlined) RocF-R5 (rev) 987–1006 GG ATCGAT CTTTTTCAACCTTTTATCGT ( Cla I site underlined) Kan-H16 (rev) NA CGGTATAATCTTACCTATCACCTCA Kan-K4 (rev) NA TCCAATTCACTGTTCCTT Kan-K5 (for) NA TATATTTAAAAATGACGG Kan-K8 (for) NA TTTGACTTACTGGGGATCAAGCCTG Plasmids (parent) pBluescript II SK (−) Ap r , cloning vector Stratagene pBS- rocF (pBluescript II SK) Ap r , 1,154-bp rocF PCR product (nucleotides −149 to 1006) cloned into the Pst I and Cla I sites This study pBS- rocF::aphA3 (pBluescript II SK) Ap r Kn r , 1.2-kb Eco RI aphA3 cassette from pHP1 ligated to the Eco RI site of rocF in pBS- rocF This study pHP1 (pUC19) Ap r Kn r , source of aphA3 cassette H. Kleanthous pILL570 Sp r , cloning vector 11 pILL570 Not (pILL570) Sp r , Not I and Eco RI sites have been introduced between the Cla I and Hin dIII sites in the pILL570 polylinker This study pILL600 Kn r , source of aphA3 cassette 12 pILL235 (pILL570 Not) Sp r , 676-bp rocF spliced PCR products (nucleotides 18 to 339 and 562 to 915) This study pILL236-2 (pILL570) Sp r Kn r , aphA3 cassette from pILL600 ligated to the Bam HI site in rocF in pILL235 This study Strains E. coli DH5α F − supE44 ΔlacU169 (φ80 lacZ ΔM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1 Bethesda Research Laboratories H. pylori 26695 WT, genome sequenced 4 , 34 26695 rocF::aphA3 26695 allelic exchange arginase ( rocF ) mutant by using pBS- rocF::aphA3 This study N6 WT, naturally transformable laboratory strain 6 N6 236-2 N6 allelic exchange arginase ( rocF ) mutant by using pILL236-2 This study N6 rocF::aphA3 N6 allelic exchange arginase ( rocF ) mutant by using pBS- rocF::aphA3 This study SS1 WT (mouse-adapted) 13 SS1 236-2 SS1 allelic exchange arginase ( rocF ) mutant by using pILL236-2 This study SS1 rocF::aphA3 SS1 allelic exchange arginase ( rocF ) mutant by using pBS- rocF::aphA3 This study Open in a separate window a +1 refers to the A residue in the start codon of rocF .

Techniques: Construct, Plasmid Preparation, Sequencing